View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1724_low_13 (Length: 207)
Name: NF1724_low_13
Description: NF1724
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1724_low_13 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 171; Significance: 5e-92; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 9 - 187
Target Start/End: Original strand, 32317213 - 32317391
Alignment:
| Q |
9 |
gattattctgagttgaattatgattctgatgagaatgggaatgatttgaataattcaaatgggactgttgttactggtggagatcagaagggaaagaaga |
108 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32317213 |
gatttttctgagttgaattatgattctgatgagaatgggaatgatttgaataattcaaatgggactgttgttactggtggagatcagaagggaaagaaga |
32317312 |
T |
|
| Q |
109 |
agaaggggcttccagcgaagaatttgatgactgagaggcgcaggaggaagaaactcaatgatagattgtacatgcttag |
187 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32317313 |
agaaggggcttccagcgaagaatttgatggctgagaggcgcaggaggaagaaactcaatgatagattgtacatgcttag |
32317391 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 52; Significance: 5e-21; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 62 - 145
Target Start/End: Original strand, 8187762 - 8187845
Alignment:
| Q |
62 |
ttcaaatgggactgttgttactggtggagatcagaagggaaagaagaagaaggggcttccagcgaagaatttgatgactgagag |
145 |
Q |
| |
|
|||||| |||||||||||||| | ||||||||||||||| ||||||||||| |||||||| || |||||||||||| ||||||| |
|
|
| T |
8187762 |
ttcaaacgggactgttgttaccgatggagatcagaaggggaagaagaagaaagggcttcctgctaagaatttgatggctgagag |
8187845 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University