View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17251_high_12 (Length: 250)
Name: NF17251_high_12
Description: NF17251
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17251_high_12 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 4 - 242
Target Start/End: Complemental strand, 10843159 - 10842912
Alignment:
| Q |
4 |
acgaaatcgttttcgtttgaggattttaattatgaattattatgtggatgtatattgaaggtgaagtatacttatcactgtcaatgcctctttcttgtgt |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10843159 |
acgaaatcgttttcgtttgaggattttaattatgaattattatgtggatgtatattgaaggtgaagtatacttatcactgtcaatgcctctttcttgtgt |
10843060 |
T |
 |
| Q |
104 |
atgtaaaagattgcagaccataaagt-ttttggttagtgaagatgagtgcttgaagatgagttttatctaatctaatagtcactaaat--------aaat |
194 |
Q |
| |
|
||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
10843059 |
atgaaaaagattgcagaccataaagttttttggttagtgaagatgagtgcttgaagatgagttttatctaatctaatagtcactaaataaaatataaaat |
10842960 |
T |
 |
| Q |
195 |
gtacaccactaaatttttctttggttcaagcattttcagtttcatctc |
242 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10842959 |
atacaccactaaatttttctttggttcaagcattttcagtttcatctc |
10842912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University