View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17252_high_6 (Length: 249)
Name: NF17252_high_6
Description: NF17252
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17252_high_6 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 130; Significance: 2e-67; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 1 - 236
Target Start/End: Original strand, 15836533 - 15836766
Alignment:
| Q |
1 |
tacggtaaaaggatgcaagtacaattgatatggttgcgaatgggtttcgatacgcaattttccattccctaccataacaaaacaaaaacaagaaacgtcg |
100 |
Q |
| |
|
||||||||||| |||||||||||| ||||||||| | ||| | ||| || |||||||| | ||||| |||||||| ||||||||||| |||||||| |
|
|
| T |
15836533 |
tacggtaaaagcatgcaagtacaaatgatatggtagggaacgtattttaatccgcaatttccaattccgtaccataa---aacaaaaacaaaaaacgtcg |
15836629 |
T |
 |
| Q |
101 |
taaacatatcaagtttgaatttaagnnnnnnn-tatgccatgactaaaatgaaaaccccaataattatagggattaaattcatatttaagttgaagataa |
199 |
Q |
| |
|
|||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
15836630 |
taaaaatatcaagtttgaatttaagaaaaaacatatgccatgactaaaatgaaaaccccaataattatagggattaaattcatatttaagtcgaagataa |
15836729 |
T |
 |
| Q |
200 |
ttgatattttacctgcataagtggtgaccacaagttc |
236 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15836730 |
ttgatattttacctgcataagtggtgaccacaagttc |
15836766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University