View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17252_low_9 (Length: 227)
Name: NF17252_low_9
Description: NF17252
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17252_low_9 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 16 - 213
Target Start/End: Complemental strand, 22922687 - 22922490
Alignment:
| Q |
16 |
aagaaagacaaaagaataaaaacatataaaggttacaaagatttacgaagcatgtcatggaactaaattagccacttggcaccgaagcaatgttttcaac |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||| ||| |
|
|
| T |
22922687 |
aagaaagacaaaagaataaaaacatataaaggttacaaagattaacgaagcatgtcatggaactaaatttgccacttggcaccgaagcaatgttttgaac |
22922588 |
T |
 |
| Q |
116 |
ttgggattcttcgtatccagttcccttaaatccattgtggaaaaagacatagttttggatcttcacgaaaaacagaagaatatcccaatggagatgat |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22922587 |
ttgggattcttcgtatccagttcccttaaatccattgtggaaaaagacatagttctggatcttcacgaaaaacagaagaatatcccaatggagatgat |
22922490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University