View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17253_high_11 (Length: 251)
Name: NF17253_high_11
Description: NF17253
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17253_high_11 |
 | |
|
| [»] scaffold0186 (1 HSPs) |
| |
|
Alignment Details
Target: scaffold0186 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: scaffold0186
Description:
Target: scaffold0186; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 5 - 251
Target Start/End: Complemental strand, 25220 - 24973
Alignment:
| Q |
5 |
tagcagcacagacacatataaaatgtaagtggcaatcaagaaaaagaataataaaggctcgtaaaataaggtgaaatctccttgataattggtgtttgaa |
104 |
Q |
| |
|
||||| |||| ||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||| ||||| |
|
|
| T |
25220 |
tagcatcacaaacacatataaaatgtaagtggaaatcaagaaaatgaataataaaggctcgtaaaatatggtgaaatctccttgataattggtgcttgaa |
25121 |
T |
|
| Q |
105 |
attcaatttcagctagagtttcaacaagct-tccaattaggagatgggagttgtaaggtatttggagaaaataaagagcaaaagcgagtttcataactcc |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||| ||||||||||||||||||| ||||||||||||||||||||| ||||| |||||||| |||||| |
|
|
| T |
25120 |
attcaatttcagctagagtttcaacaagctgtccaactaggagatgggagttgtaacgtatttggagaaaataaagagtaaaagtgagtttcacaactcc |
25021 |
T |
|
| Q |
204 |
ttattagatcacaattaaggaaacttgagaaaaaagttgtagtttcat |
251 |
Q |
| |
|
||||||||||||||||||||| |||||| |||||||| |||||||||| |
|
|
| T |
25020 |
ttattagatcacaattaaggacacttgaaaaaaaagtcgtagtttcat |
24973 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University