View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17253_high_13 (Length: 236)
Name: NF17253_high_13
Description: NF17253
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17253_high_13 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 105; Significance: 1e-52; HSPs: 9)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 1 - 173
Target Start/End: Complemental strand, 20611166 - 20610995
Alignment:
| Q |
1 |
caaggttttgcttacattgcttttttgttctctttctgaattttgtttcaactctctttccagataaggtttttgttataactggtttggcatttttgaa |
100 |
Q |
| |
|
|||||||||||||||||| |||||| ||||| ||| |||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||| || |
|
|
| T |
20611166 |
caaggttttgcttacattactttttagttctttttgtgaattttgtttcaactctctttccagatagtggttttgttataactggtttggcattttttaa |
20611067 |
T |
 |
| Q |
101 |
ctctataaccagtttggtattttgtttacattttactgtaattggttttgatttttctattgctcccaaacat |
173 |
Q |
| |
|
||| ||||| |||||| ||||||||||||| |||||| | |||||||| |||||||||||||||| ||||||| |
|
|
| T |
20611066 |
ctcaataacgagtttgttattttgtttaca-tttactattattggtttggatttttctattgctctcaaacat |
20610995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 1 - 100
Target Start/End: Complemental strand, 20585012 - 20584913
Alignment:
| Q |
1 |
caaggttttgcttacattgcttttttgttctctttctgaattttgtttcaactctctttccagataaggtttttgttataactggtttggcatttttgaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||| |||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
20585012 |
caaggttttgcttacattgcttttttgttctctttgtgaattttgtttcaactctatttacagatagtatttttgttataactggtttggcatttttgaa |
20584913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 1 - 96
Target Start/End: Original strand, 20895837 - 20895932
Alignment:
| Q |
1 |
caaggttttgcttacattgcttttttgttctctttctgaattttgtttcaactctctttccagataaggtttttgttataactggtttggcatttt |
96 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||| | |||||||||||||||||||||||||| |
|
|
| T |
20895837 |
caaggttttgcttacattgcttttttgttctctttgtgaattttgtttcaactctctttctagatagtggttttgttataactggtttggcatttt |
20895932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 1 - 121
Target Start/End: Complemental strand, 20603339 - 20603227
Alignment:
| Q |
1 |
caaggttttgcttacattgcttttttgttctctttctgaattttgtttcaactctctttccagataaggtttttgttataactggtttggcatttttgaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||| | ||||||| |||||||||||||||| |
|
|
| T |
20603339 |
caaggttttgcttacattgcttttttgttctctttgtgaattttgtttcaactctc-ttccagatagtggttttgtt-------gtttggcatttttgaa |
20603248 |
T |
 |
| Q |
101 |
ctctataaccagtttggtatt |
121 |
Q |
| |
|
||||||||| ||||||||||| |
|
|
| T |
20603247 |
ctctataacgagtttggtatt |
20603227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 1 - 63
Target Start/End: Original strand, 20895690 - 20895752
Alignment:
| Q |
1 |
caaggttttgcttacattgcttttttgttctctttctgaattttgtttcaactctctttccag |
63 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
20895690 |
caaggttttgcttacattgcttttttgttctctttgtgaattttgtttcaactctctttccag |
20895752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 112 - 190
Target Start/End: Original strand, 20895921 - 20895999
Alignment:
| Q |
112 |
gtttggtattttgtttacattttactgtaattggttttgatttttctattgctcccaaacatatggcctgtcatttagt |
190 |
Q |
| |
|
|||||| |||||||||| |||||||||| ||||||||||||||||||||||||| |||||||||||||| ||||||||| |
|
|
| T |
20895921 |
gtttggcattttgtttatattttactgttattggttttgatttttctattgctctcaaacatatggcctctcatttagt |
20895999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 114 - 190
Target Start/End: Complemental strand, 20595848 - 20595772
Alignment:
| Q |
114 |
ttggtattttgtttacattttactgtaattggttttgatttttctattgctcccaaacatatggcctgtcatttagt |
190 |
Q |
| |
|
|||| ||||||||||||||||||| | |||||| | |||||||||||||||| ||||||||||| | ||||||||| |
|
|
| T |
20595848 |
ttggcattttgtttacattttactattattggtatggatttttctattgctctcaaacatatggattttcatttagt |
20595772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 141 - 190
Target Start/End: Complemental strand, 20603226 - 20603177
Alignment:
| Q |
141 |
attggttttgatttttctattgctcccaaacatatggcctgtcatttagt |
190 |
Q |
| |
|
|||||||| ||||| |||||||||| |||||||||||||| ||||||||| |
|
|
| T |
20603226 |
attggtttggatttatctattgctctcaaacatatggcctatcatttagt |
20603177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 191 - 221
Target Start/End: Original strand, 20896039 - 20896069
Alignment:
| Q |
191 |
aaatataatctcacagttattatgttattag |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
20896039 |
aaatataatctcacagttattatgttattag |
20896069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University