View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17253_high_6 (Length: 345)
Name: NF17253_high_6
Description: NF17253
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17253_high_6 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 96 - 333
Target Start/End: Complemental strand, 33655408 - 33655171
Alignment:
| Q |
96 |
ctactaaactaccaataaaaccctcttgcatcaatatcttgtacagttagctccagaagtttgttactcttattgattttgaaaattgcagattatagct |
195 |
Q |
| |
|
|||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33655408 |
ctactaaattaccaataaaaccctcctgcatcaatatcttgtacagttagctccagaagtttgttactcttattgattttgaaaattgcagattatagct |
33655309 |
T |
 |
| Q |
196 |
tgccagcatcagttcaaacaccatcatccgatggaagggctcaaatgccgaggtcatggccgaaccatcatccacactacattcacaattttcagggtca |
295 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
33655308 |
tgccagcatcagttcaaacaccatcatccgatggaagggctcaaatgctgaggtcatggccgaaccatcatccacagtacattcacaattttcagggtca |
33655209 |
T |
 |
| Q |
296 |
tggatttcaacaaacacctccataccaaggatacatgt |
333 |
Q |
| |
|
|| |||||||||||| |||||||||||||||||||||| |
|
|
| T |
33655208 |
tgcatttcaacaaacgcctccataccaaggatacatgt |
33655171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University