View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17254_high_8 (Length: 248)
Name: NF17254_high_8
Description: NF17254
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17254_high_8 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 154; Significance: 8e-82; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 154; E-Value: 8e-82
Query Start/End: Original strand, 18 - 229
Target Start/End: Complemental strand, 51114683 - 51114462
Alignment:
| Q |
18 |
agagacttgagaagaacacactccgatgtcacattttaatgtaggtttcattttgttttgtaccttatttgccgtgtgaaatgaactaca---------- |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
51114683 |
agagacttgagaagaacacactccgatgtcacattttaatgtaggtttcattttgttttgtatcttatttgccgtgtgaaatgaactacagacatacaca |
51114584 |
T |
 |
| Q |
108 |
tttcaagcatgcattctatctaacttctaatccaacacataaataaggttcaaacaccaatggacatgaataattagcagaatattttctcagatatctn |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
51114583 |
tttcaagcatgcattctatctaacttctaatccaacaaataaataaggttcaaacaccaatggacatgaataatttgcagaatattttctcagatatcta |
51114484 |
T |
 |
| Q |
208 |
nnnnnngaaagagataatcaag |
229 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
51114483 |
aaaaaagaaagagataatcaag |
51114462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University