View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17255_high_19 (Length: 290)
Name: NF17255_high_19
Description: NF17255
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17255_high_19 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 251; Significance: 1e-139; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 18 - 276
Target Start/End: Complemental strand, 38548151 - 38547893
Alignment:
| Q |
18 |
ctttgcagttgagtttgatgattataggaatgaagagtttaatgaagttaatgataatcatgttgctgttgatttgaattctattatttctaattattct |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
38548151 |
ctttgcagttgagtttgatgattataggaatgaagagtttaatgaagttaatgataatcatgttggtgttgatttgaattctattatttctaattattct |
38548052 |
T |
|
| Q |
118 |
gaacctgctgagttttggggtggtggaaaaaatggtgatgaattggaaaagttgaaactgtctagtggtgaaaattatcaagtttggattgagtttaggg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38548051 |
gaacctgctgagttttggggtggtggaaaaaatggtgatgaattggaaaagttgaaactgtctagtggtgaaaattatcaagtttggattgagtttaggg |
38547952 |
T |
|
| Q |
218 |
agtttgaaattaatgttaccatggctccggcggggaaaagaaaacctaataggcctttg |
276 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38547951 |
agtttgaaattaatgttactatggctccggcggggaaaagaaaacctaataggcctttg |
38547893 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University