View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17255_high_23 (Length: 250)
Name: NF17255_high_23
Description: NF17255
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17255_high_23 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 113; Significance: 2e-57; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 1 - 146
Target Start/End: Complemental strand, 37335425 - 37335285
Alignment:
| Q |
1 |
atagttgcatcatatatgattcagtcgcatgcatgctcgcaacgtgtagtatgagaaatgtaaactacataacattttttattgagaggtacggcgttga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||| |
|
|
| T |
37335425 |
atagttgcatcatatatgattcagtcgcatgcatgctcgcaacgtgtagtatgagaaatgtaaac----taacattttttattgagaggtacggcattga |
37335330 |
T |
 |
| Q |
101 |
tttccaaaaatatttataacttaattttgctgaccaaatagatata |
146 |
Q |
| |
|
|||||||||||||||||||||||| |||| |||||||||||||||| |
|
|
| T |
37335329 |
tttccaaaaatatttataacttaa-tttgttgaccaaatagatata |
37335285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 168 - 243
Target Start/End: Complemental strand, 37335228 - 37335146
Alignment:
| Q |
168 |
caaaggagaattcaaagcaaagtatggataaacgcatg-------gtcagtggtcagtgtagaaaatgttttgagaataatct |
243 |
Q |
| |
|
|||| ||||||||||||||||| ||||||||||||||| |||| ||||||||| ||||||||||||||||||||||| |
|
|
| T |
37335228 |
caaacgagaattcaaagcaaagcatggataaacgcatggtcactggtcactggtcagtgaagaaaatgttttgagaataatct |
37335146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University