View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17255_high_24 (Length: 250)

Name: NF17255_high_24
Description: NF17255
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17255_high_24
NF17255_high_24
[»] chr5 (2 HSPs)
chr5 (16-110)||(25030450-25030544)
chr5 (190-231)||(25030041-25030082)


Alignment Details
Target: chr5 (Bit Score: 79; Significance: 5e-37; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 16 - 110
Target Start/End: Complemental strand, 25030544 - 25030450
Alignment:
16 aggagagccaacatctcaaaaacatggtgggtaacaagtttgatttgtttgtgctgatacaagaattgaagccattctgtattattcttcaggta 110  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| | || ||||| ||||||||||||||||||||||||||||||    
25030544 aggagagccaacatctcaaaaacatggtgggtaacaagtttgatttgtttgtgtttatgcaagagttgaagccattctgtattattcttcaggta 25030450  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 190 - 231
Target Start/End: Complemental strand, 25030082 - 25030041
Alignment:
190 gggttatggacggtggtgtggagtatgctgtgaggccgaggc 231  Q
    ||||||||||||||||||||||||||||||||||||||||||    
25030082 gggttatggacggtggtgtggagtatgctgtgaggccgaggc 25030041  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University