View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17255_low_22 (Length: 269)
Name: NF17255_low_22
Description: NF17255
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17255_low_22 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 1 - 192
Target Start/End: Complemental strand, 38547881 - 38547690
Alignment:
| Q |
1 |
tattaatttttcttgggtttgtgtggatgaaatgtatgttggattttcgggatcgactgggagaatggttgatacttgtagaattttagcttggagtttt |
100 |
Q |
| |
|
||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38547881 |
tattaatttttctagggtttttgtggatgaaatgtatgttggattttcgggatcgactgggagaatggttgatacttgtagaattttagcttggagtttt |
38547782 |
T |
 |
| Q |
101 |
agtcattcgaatttttcgattggtgatgctttgaatactaaaaatttgcctacatatgtgaatccaaagaaattcatatataaatctaaggc |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38547781 |
agtcattcgaatttttcgattggtgatgctttgaatactaaaaatttgcctacatatgtgaatccaaagaaattcatatataaatctaaggc |
38547690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University