View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17255_low_22 (Length: 269)

Name: NF17255_low_22
Description: NF17255
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17255_low_22
NF17255_low_22
[»] chr2 (1 HSPs)
chr2 (1-192)||(38547690-38547881)


Alignment Details
Target: chr2 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 1 - 192
Target Start/End: Complemental strand, 38547881 - 38547690
Alignment:
1 tattaatttttcttgggtttgtgtggatgaaatgtatgttggattttcgggatcgactgggagaatggttgatacttgtagaattttagcttggagtttt 100  Q
    ||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38547881 tattaatttttctagggtttttgtggatgaaatgtatgttggattttcgggatcgactgggagaatggttgatacttgtagaattttagcttggagtttt 38547782  T
101 agtcattcgaatttttcgattggtgatgctttgaatactaaaaatttgcctacatatgtgaatccaaagaaattcatatataaatctaaggc 192  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38547781 agtcattcgaatttttcgattggtgatgctttgaatactaaaaatttgcctacatatgtgaatccaaagaaattcatatataaatctaaggc 38547690  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University