View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17255_low_23 (Length: 260)
Name: NF17255_low_23
Description: NF17255
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17255_low_23 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 1 - 249
Target Start/End: Original strand, 26199480 - 26199728
Alignment:
| Q |
1 |
ggatcactcacgatcccttcatccattccttttcttcagcgaaagggagttcttgtggtctcctctgtaattggcacatcttctagtagatatgaaatgt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
26199480 |
ggatcactcacgatcccttcatccattccttttcgtcagcgaaagggagttcttgtggtctcctctgtaattgacacatcttctagtagatatgaaatgt |
26199579 |
T |
 |
| Q |
101 |
gatctttggctctttgacggtggtttgtgtccatttccactgtgctttctggatatggacctaagagaccctaataggtgatgacatatcaatttgggat |
200 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26199580 |
gatctttggctccttgacggtggtttgtgtccatttccactgtgctttctggatatggacctaagagaccctaataggtgatgacatatcaatttgggat |
26199679 |
T |
 |
| Q |
201 |
gttcgatctcctcaggaaggaaattgttctctcttgacaaatgatgatg |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26199680 |
gttcgatctcctcaggaaggaaattgttctctcttgacaaatgatgatg |
26199728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University