View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17255_low_26 (Length: 250)
Name: NF17255_low_26
Description: NF17255
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17255_low_26 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 79; Significance: 5e-37; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 16 - 110
Target Start/End: Complemental strand, 25030544 - 25030450
Alignment:
| Q |
16 |
aggagagccaacatctcaaaaacatggtgggtaacaagtttgatttgtttgtgctgatacaagaattgaagccattctgtattattcttcaggta |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| | || ||||| |||||||||||||||||||||||||||||| |
|
|
| T |
25030544 |
aggagagccaacatctcaaaaacatggtgggtaacaagtttgatttgtttgtgtttatgcaagagttgaagccattctgtattattcttcaggta |
25030450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 190 - 231
Target Start/End: Complemental strand, 25030082 - 25030041
Alignment:
| Q |
190 |
gggttatggacggtggtgtggagtatgctgtgaggccgaggc |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25030082 |
gggttatggacggtggtgtggagtatgctgtgaggccgaggc |
25030041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University