View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17255_low_34 (Length: 214)

Name: NF17255_low_34
Description: NF17255
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17255_low_34
NF17255_low_34
[»] chr4 (1 HSPs)
chr4 (58-195)||(7653562-7653699)
[»] chr3 (1 HSPs)
chr3 (48-161)||(20592617-20592730)
[»] chr7 (1 HSPs)
chr7 (58-152)||(11362343-11362436)
[»] chr6 (1 HSPs)
chr6 (58-152)||(4059295-4059388)
[»] chr5 (1 HSPs)
chr5 (61-152)||(21905454-21905544)


Alignment Details
Target: chr4 (Bit Score: 130; Significance: 2e-67; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 58 - 195
Target Start/End: Original strand, 7653562 - 7653699
Alignment:
58 gatggtgtttcacggtggtttggggtctgagtttgggtttcacggtggtggtttggggattgggtttcgattgagaatggaggtaaagggagaacagttg 157  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||    
7653562 gatggtgtttcacggtggtttggggtctgagtttgggtttcacggtggtggtttggggattgtgtttcgattgagaatggaggaaaagggagaacagttg 7653661  T
158 ggttttgattgggttcgattgagaaggattgggttttg 195  Q
    ||||||||||||||||||||||||||||||||||||||    
7653662 ggttttgattgggttcgattgagaaggattgggttttg 7653699  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 90; Significance: 1e-43; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 48 - 161
Target Start/End: Original strand, 20592617 - 20592730
Alignment:
48 agtgtttcatgatggtgtttcacggtggtttggggtctgagtttgggtttcacggtggtggtttggggattgggtttcgattgagaatggaggtaaaggg 147  Q
    ||||||||| ||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||    
20592617 agtgtttcacgatggtgtttcacggtggtttggggtctgagcttgggtttcacagtggtggtttggggattgggtttcgattgagaatggaggaaaaggg 20592716  T
148 agaacagttgggtt 161  Q
    |||||  |||||||    
20592717 agaacgattgggtt 20592730  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 67; Significance: 6e-30; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 67; E-Value: 6e-30
Query Start/End: Original strand, 58 - 152
Target Start/End: Complemental strand, 11362436 - 11362343
Alignment:
58 gatggtgtttcacggtggtttggggtctgagtttgggtttcacggtggtggtttggggattgggtttcgattgagaatggaggtaaagggagaac 152  Q
    |||||||||||||||||||||||||||||| |||||||||||||||||||||||  |||||||||| ||||||| |||||||| |||||||||||    
11362436 gatggtgtttcacggtggtttggggtctgactttgggtttcacggtggtggttt-aggattgggttacgattgaaaatggaggaaaagggagaac 11362343  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 67; Significance: 6e-30; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 67; E-Value: 6e-30
Query Start/End: Original strand, 58 - 152
Target Start/End: Complemental strand, 4059388 - 4059295
Alignment:
58 gatggtgtttcacggtggtttggggtctgagtttgggtttcacggtggtggtttggggattgggtttcgattgagaatggaggtaaagggagaac 152  Q
    |||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||  |||||| |||||||| |||||||||||    
4059388 gatggtgtttcacggtggtttggggtctgactttgggtttcacggtggtggttt-gggattgggttatgattgaaaatggaggaaaagggagaac 4059295  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 60; Significance: 9e-26; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 60; E-Value: 9e-26
Query Start/End: Original strand, 61 - 152
Target Start/End: Original strand, 21905454 - 21905544
Alignment:
61 ggtgtttcacggtggtttggggtctgagtttgggtttcacggtggtggtttggggattgggtttcgattgagaatggaggtaaagggagaac 152  Q
    ||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||| ||||||| |||||| | ||| |||||||    
21905454 ggtgtttcacggtggtttggggtctgaatttgggtttcacggtggtggttt-gggattgggttgcgattgaaaatggacgaaaaaggagaac 21905544  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University