View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17256_high_16 (Length: 222)
Name: NF17256_high_16
Description: NF17256
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17256_high_16 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 16 - 185
Target Start/End: Original strand, 41472430 - 41472599
Alignment:
| Q |
16 |
aaaatcatgaaaaataacctcgcaccaacatatctgatcaaatgggcggccggtatccatcacagacatacacaacaaatgtgattactttcaattaatt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41472430 |
aaaatcatgaaaaataacctcgcaccaacatatctgatcaaatgggcggccggtatccatcacagacatacacaacaaatgtgattactttcaattaatt |
41472529 |
T |
|
| Q |
116 |
cacattctcaaattatcaacgttgtgagtgtcgtgtctgtgtcggtacttcgcagataaaaacacagggt |
185 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
41472530 |
cacattctcaaattatcaacgttgtgagtgtcgtgtctgtgtcgatacttcgcagataaaaacacagggt |
41472599 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 88 - 133
Target Start/End: Complemental strand, 28322294 - 28322249
Alignment:
| Q |
88 |
caacaaatgtgattactttcaattaattcacattctcaaattatca |
133 |
Q |
| |
|
||||| |||||||||| ||||||||||||| |||||||||||||| |
|
|
| T |
28322294 |
caacacatgtgattacattcaattaattcattttctcaaattatca |
28322249 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University