View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17256_high_7 (Length: 343)

Name: NF17256_high_7
Description: NF17256
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17256_high_7
NF17256_high_7
[»] chr5 (2 HSPs)
chr5 (43-174)||(17030255-17030386)
chr5 (174-212)||(17030032-17030070)
[»] chr7 (1 HSPs)
chr7 (174-228)||(4858741-4858795)


Alignment Details
Target: chr5 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 43 - 174
Target Start/End: Complemental strand, 17030386 - 17030255
Alignment:
43 atttttgttttacctacagatgcttgccgtaggtacagagcctactgagacctgataaatagttttacctacgaccgtataagtaaccggaaataatatg 142  Q
    ||||| ||||||||||| |||  ||||| || | ||||||||||  | |  || |||||| |||||| ||||| |||||| |||||  ||  ||||||||    
17030386 attttagttttacctacggatttttgccataagcacagagcctagcgtggactaataaattgttttaactacggccgtattagtaattggtcataatatg 17030287  T
143 ctttatctgaaactttttcttatcatattttt 174  Q
    |||||| || ||||||||||||||||||||||    
17030286 ctttatatgcaactttttcttatcatattttt 17030255  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 174 - 212
Target Start/End: Complemental strand, 17030070 - 17030032
Alignment:
174 tacaataaattaaataaatgaacttatgaaacaataaaa 212  Q
    |||||||||||||||||||||||||||||||||||||||    
17030070 tacaataaattaaataaatgaacttatgaaacaataaaa 17030032  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 174 - 228
Target Start/End: Complemental strand, 4858795 - 4858741
Alignment:
174 tacaataaattaaataaatgaacttatgaaacaataaaattaaccttcaattata 228  Q
    ||||||||||||||||||  || ||||||||||||||||| || |||| ||||||    
4858795 tacaataaattaaataaaataatttatgaaacaataaaataaaacttctattata 4858741  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University