View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17256_low_16 (Length: 262)
Name: NF17256_low_16
Description: NF17256
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17256_low_16 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 125; Significance: 2e-64; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 115 - 250
Target Start/End: Original strand, 28734260 - 28734396
Alignment:
| Q |
115 |
ggcaaccctaaactatctttatcaagaaggtgttgaatgaaggggggtggggcaggccaccattggg-aagaaaacaaagagagcccttgtccattttta |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
28734260 |
ggcaaccctaaactatctttatcaagaaggtgttgaatgaaggggggtggggcaggccaccattgggaaagaaaacaaagagagcccttgtccattttta |
28734359 |
T |
 |
| Q |
214 |
gccaattaatgcatctgccaccatgttaccttcccta |
250 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||| |
|
|
| T |
28734360 |
gccaattaatgcatctgccaccatattaccttcccta |
28734396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University