View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17257_high_19 (Length: 250)
Name: NF17257_high_19
Description: NF17257
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17257_high_19 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 1 - 237
Target Start/End: Original strand, 6505327 - 6505569
Alignment:
| Q |
1 |
ttttcttagtcattgaatatgcataataggacatatttgcagcaagttgttgcttaaactgttggttgttgatcgttgaata------caaggagccatt |
94 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||| |
|
|
| T |
6505327 |
ttttcttagtcattgaatatgcataataggacatatttgcagcaagttgttgcttaaactgttggttgttgatcgttgaatatgcatacgaggagccatt |
6505426 |
T |
 |
| Q |
95 |
ggcgcattctcatccctttaaataatataataatatgtcatcagacagttcaaaacatattataatgttttggttcaatatcacctccttccaacgttta |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||| || ||||| |
|
|
| T |
6505427 |
ggcgcattctcatccctttaaataatataataatatgtcttcagacagttcaaaacatattataatattttggttcaatatcacctccttctaatgttta |
6505526 |
T |
 |
| Q |
195 |
tctgaaacctttgtgaacgttggatttgagaaaacttctagaa |
237 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
6505527 |
tctgaaacctttgtgaacgttggatttgacaaaacttctagaa |
6505569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University