View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17257_low_17 (Length: 267)
Name: NF17257_low_17
Description: NF17257
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17257_low_17 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 19 - 261
Target Start/End: Complemental strand, 36476380 - 36476131
Alignment:
| Q |
19 |
ggcttccttcctacacgcgagagattggttatga-------gagggattcaatgtccaatacatcgcaggtctggacagaagctggatgctggaatcagc |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36476380 |
ggcttccttcctacacgcgagagattggttatgacttatgagagggattcaatgtccaatacatcgcaggtctggacagaagctggatgctggaatcagc |
36476281 |
T |
|
| Q |
112 |
ggcagaatattgccggaaatgcatcagatattgcagatttggtatttctcgtgctggaaaatcttcctagtcagaagacgaattaatttgcagcaaccat |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
36476280 |
tgcagaatattgccggaaatgcatcagatattgcagatttggtatttctcgtgctggaaaatcttcctagtcagaagacgaattgatttgcagcaaccat |
36476181 |
T |
|
| Q |
212 |
gtggggaatttggtggaaaataaactgaaaaatttgggagaatgaggatc |
261 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36476180 |
gtggggaatttggtggaaaataaactgaaaaatttgggagaatgaggatc |
36476131 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University