View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17257_low_9 (Length: 442)
Name: NF17257_low_9
Description: NF17257
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17257_low_9 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 430; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 430; E-Value: 0
Query Start/End: Original strand, 1 - 442
Target Start/End: Original strand, 24676842 - 24677283
Alignment:
| Q |
1 |
accaccctctttgccctaaaagtcgttgacaaaacctccatccacgccaaacttgacgccgaacgccgcgcccgatgggaaatccaagtcctctccaccc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24676842 |
accaccctctttgccctaaaagtcgttgacaaaacctccatccacgccaaacttgacgccgaacgccgcgcccgatgggaaatccaagtcctctccaccc |
24676941 |
T |
 |
| Q |
101 |
tctcccaccctttcctcccttcaatccttggtacatatgaatccccacagtttcttgcatgggccctaccttattgtcccggtggtgacctcaatgttct |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| || |
|
|
| T |
24676942 |
tctcccaccctttcctcccttcaatccttggtacatatgaatccccacagtttcttgcatgggccctgccttattgtcccggtggtgacctcaatgtcct |
24677041 |
T |
 |
| Q |
201 |
ccgttaccgtcaaaacgaccgtgttttctctccgtccgttgtccggttctacctagctgaaatcctctgcgctctcgaccaccttcattccatgggcatc |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24677042 |
ccgttaccgtcaaaacgaccgtgttttctctccgtccgttgtccggttctacctagctgaaatcctctgcgctctcgaccaccttcattccatgggcatt |
24677141 |
T |
 |
| Q |
301 |
gtttaccgtgacctaaaaccagaaaatgttctaatacaacattccggccacgtcacgttaaccgatttcgacctctcacgtaaacttaacccaagaactt |
400 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24677142 |
gtttaccgtgacctaaaaccagaaaatgttctaatacaacattccggccacgtcacgttaaccgatttcgacctctcacgtaaacttaacccaagaactt |
24677241 |
T |
 |
| Q |
401 |
ttaaaaccgttgttgcaacaccaccaccacctttaccagatt |
442 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24677242 |
ttaaaaccgttgttgcaacaccaccaccacctttaccagatt |
24677283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 53; Significance: 3e-21; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 247 - 387
Target Start/End: Original strand, 41986463 - 41986603
Alignment:
| Q |
247 |
ttctacctagctgaaatcctctgcgctctcgaccaccttcattccatgggcatcgtttaccgtgacctaaaaccagaaaatgttctaatacaacattccg |
346 |
Q |
| |
|
|||||| |||| || || ||||||||||| | || |||||| |||||||||| | ||| |||||||| ||||| ||||| ||||| || ||||| || | |
|
|
| T |
41986463 |
ttctacatagcagagattctctgcgctcttcaacatcttcataccatgggcatagcttatcgtgaccttaaacctgaaaacgttcttattcaacaatctg |
41986562 |
T |
 |
| Q |
347 |
gccacgtcacgttaaccgatttcgacctctcacgtaaactt |
387 |
Q |
| |
|
|||||||||| ||||| |||||||| ||||||||||||||| |
|
|
| T |
41986563 |
gccacgtcaccttaactgatttcgatctctcacgtaaactt |
41986603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University