View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17258_high_8 (Length: 211)
Name: NF17258_high_8
Description: NF17258
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17258_high_8 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 93; Significance: 2e-45; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 98 - 198
Target Start/End: Complemental strand, 38693279 - 38693179
Alignment:
| Q |
98 |
gatgagtgttagatgcacaatatacatctagtactatgtctatgcaataaaagaaattcccaacgggagttgcaagagttttcttaacaataaagtatta |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||| |
|
|
| T |
38693279 |
gatgagtgttagatgcacaatatacatctagtactatgtctatgcaataaaagaaattcccgatgggagttgcaagagttttcttaacaataaagtatta |
38693180 |
T |
 |
| Q |
198 |
t |
198 |
Q |
| |
|
| |
|
|
| T |
38693179 |
t |
38693179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University