View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17259_high_15 (Length: 517)
Name: NF17259_high_15
Description: NF17259
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17259_high_15 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 149; Significance: 2e-78; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 149; E-Value: 2e-78
Query Start/End: Original strand, 29 - 193
Target Start/End: Original strand, 39923872 - 39924036
Alignment:
| Q |
29 |
ctcaactcgtgaatctattatcaatgaaacatcaacattgaaccctgtgctggttggttaggtaggtaaatgttgcacaacgtcacccttcatacctacc |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39923872 |
ctcaactcgtgaatctattatcaatgaaacatcaacattgaaccctgtgctggttggttaggtaggtaaatgttgcacaacgtcacccttcatacctacc |
39923971 |
T |
|
| Q |
129 |
ctgtgtcttttctcattaattccacacttctattatcaacttatacgatacaaaatcgatacgac |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||| | ||||||||| |
|
|
| T |
39923972 |
ctgtgtcttttctcattaattccacacttctattatcaacttagacgatacagatacgatacgac |
39924036 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 267 - 335
Target Start/End: Original strand, 39924107 - 39924176
Alignment:
| Q |
267 |
gcaatatatacatataagtaatattg-atgaaaattgacaattaatcaattacatatattttgataaaaa |
335 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| ||||||||||| ||||||||||| |||||||||| |
|
|
| T |
39924107 |
gcaatatatacatataagtaatattttatgaaaatggacaattaatcgattacatatatcttgataaaaa |
39924176 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 469 - 500
Target Start/End: Original strand, 39924172 - 39924203
Alignment:
| Q |
469 |
aaaaatcatgtttcctcaataatagaaaaatc |
500 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
39924172 |
aaaaatcatgtttcctcaataatagaaaaatc |
39924203 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 42; Significance: 0.00000000000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 331 - 392
Target Start/End: Complemental strand, 28247545 - 28247484
Alignment:
| Q |
331 |
aaaaaatatctttacttaatcaattacatatatctcaaaatgaaaacatcattattgttata |
392 |
Q |
| |
|
|||||| ||||||||| ||||||||||||||||||||||| || |||||| ||||||||||| |
|
|
| T |
28247545 |
aaaaaacatctttactcaatcaattacatatatctcaaaaagataacatccttattgttata |
28247484 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University