View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17259_high_31 (Length: 369)
Name: NF17259_high_31
Description: NF17259
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17259_high_31 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 181; Significance: 1e-97; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 181; E-Value: 1e-97
Query Start/End: Original strand, 1 - 249
Target Start/End: Original strand, 38151349 - 38151602
Alignment:
| Q |
1 |
aaaactagtgtaaagctg---taactcaggtgtgagttttagacagatgatcccccctct--ctagaaaaactttctctgggcttttaggatttggtggc |
95 |
Q |
| |
|
||||||||||||||| || ||| |||| |||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38151349 |
aaaactagtgtaaagttgcaataagtcagatgtgagttttagacagatgaacccccctctctctagaaaaactttctctgggcttttaggatttggtggt |
38151448 |
T |
 |
| Q |
96 |
ttcctcctatctctttggtggtcttcttcctcctcctatctgtttggaagttttcactcttctagtcttgtttcccttttcacaaaaaggctccaccttt |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||| |
|
|
| T |
38151449 |
ttcctcctatctctttggtggtcttcttcctcttcctatctgtttggaagttttcactcttctagtcttgtttcccttttcacagaaagcctccaccttt |
38151548 |
T |
 |
| Q |
196 |
aaccaaaaggttctcctacttaccctcatgcccccttctcttcttcccactacc |
249 |
Q |
| |
|
||||||||| |||||||| ||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
38151549 |
aaccaaaagcttctcctatttaccctcacgcccccttctcttcttccctctacc |
38151602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 240 - 363
Target Start/End: Original strand, 38151711 - 38151834
Alignment:
| Q |
240 |
tcccactaccttccagctctgccttgagcgatcgtcactcattgccgctgcttcttctctgatggagcgttcccgaccaacaaaaaatcactccgatgcg |
339 |
Q |
| |
|
|||||||||||||||||||||| |||||||| | ||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||| |
|
|
| T |
38151711 |
tcccactaccttccagctctgctttgagcgaccatcactcattgccgctgcttcttctctgatggagcgttcctgatcaacaaaaaatcactccgatgcg |
38151810 |
T |
 |
| Q |
340 |
actgcctctaaacaccgttttcat |
363 |
Q |
| |
|
|| ||||||||||| |||||||| |
|
|
| T |
38151811 |
accacctctaaacactgttttcat |
38151834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University