View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17259_high_49 (Length: 243)
Name: NF17259_high_49
Description: NF17259
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17259_high_49 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 98; Significance: 2e-48; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 1 - 140
Target Start/End: Complemental strand, 1848459 - 1848313
Alignment:
| Q |
1 |
caaacaaacttcttggatcagaagtgtcagatcacataggttaatagattcgtaaagtgagaaggtatacattaaaagtcatgaaaaatatatgcggaaa |
100 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
1848459 |
caaacacacttcttggatcagaagtgtcagatcacatagg--aatagattcgtaaagtgagaaggtatacattaaaagtcatgaaaaatatatgaggaaa |
1848362 |
T |
 |
| Q |
101 |
atggtttg---------atagtggatcatggaaggatggtatgaatgat |
140 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
1848361 |
atggtttgatgagattaatagtggatcatggaaggatggtatgaatgat |
1848313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University