View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17259_high_52 (Length: 235)
Name: NF17259_high_52
Description: NF17259
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17259_high_52 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 101; Significance: 3e-50; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 89 - 221
Target Start/End: Complemental strand, 35379471 - 35379339
Alignment:
| Q |
89 |
tagatatgtatttttcttcaataattaacaaatttaaaacnnnnnnnnaactagttctgttgatctcgaaacagttgattctcccaaacaatcaggggcc |
188 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35379471 |
tagatatatatttttcttcaataattaacaaatttaaaacttttttttaactagttctgttgatctcgaaacagttgattctcccaaacaatcaggggcc |
35379372 |
T |
 |
| Q |
189 |
tcctctagcttgttttacctccaacttatatat |
221 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| |
|
|
| T |
35379371 |
tcctctagcttgttttacctccaacttttatat |
35379339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 1 - 90
Target Start/End: Complemental strand, 35379883 - 35379795
Alignment:
| Q |
1 |
ccttctttatgttgatcacatgcacatccatgcatttcactattggtccctccatatcatgcatattccatagcagtc-ggtagatagcta |
90 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||| | ||| |||| |||||||||||| |
|
|
| T |
35379883 |
ccttctttatgttgatcacatgcacatccatgcatttccctattggtccctcc--atcatgcatattgcgtagtagtcgggtagatagcta |
35379795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University