View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17259_high_54 (Length: 227)
Name: NF17259_high_54
Description: NF17259
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17259_high_54 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 140; Significance: 2e-73; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 12 - 208
Target Start/End: Complemental strand, 8626429 - 8626231
Alignment:
| Q |
12 |
aagcaaaggtagcttatgtctgtcaaacaaagattgcacattcacaattaagacatcgtactagtaattcataattccaatnnnnnnnn--tactcaaag |
109 |
Q |
| |
|
|||| |||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
8626429 |
aagccaaggtagcttatgtttgtcaaacaaagattgcacattcacaattaagaaatcgtactagtaattcataattccaattaaaaaaaaatactcaaag |
8626330 |
T |
|
| Q |
110 |
ttcccatttgtaatggtagcacctgcattggagaaactaatcaaattaacaattcaataaatgcatatagcaccgacacctctaatcgttggtgtatcc |
208 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
8626329 |
ttcccatttgtaatggtagcatctgcattggagaaactaatcaaattaacaattcaataaatgcatgtagcaccaacacctctaatcgttggtgtatcc |
8626231 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 114 - 171
Target Start/End: Original strand, 3501037 - 3501094
Alignment:
| Q |
114 |
catttgtaatggtagcacctgcattggagaaactaatcaaattaacaattcaataaat |
171 |
Q |
| |
|
|||||||||||||| || ||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
3501037 |
catttgtaatggtaacatctgcattggagaaactaatcaaattaataattcaataaat |
3501094 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University