View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17259_low_28 (Length: 401)
Name: NF17259_low_28
Description: NF17259
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17259_low_28 |
 |  |
|
| [»] scaffold0131 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr4 (Bit Score: 350; Significance: 0; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 350; E-Value: 0
Query Start/End: Original strand, 17 - 378
Target Start/End: Complemental strand, 26517717 - 26517356
Alignment:
| Q |
17 |
caaaggtggcttggagcattcttctagcgacttagattttgatgaaaaacgtagaaggtgatcgacttcttttgatattgttcttaccttcactgtttta |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26517717 |
caaaggtggcttggagcattcttctagcgacttagattctgatgaagaacgtagaaggtgatcgacttcttttgatattgttcttaccttcactgtttta |
26517618 |
T |
 |
| Q |
117 |
ttctgttggtctttcataattggggaatctaactgtatactcatatcagatatgatgaacaaatggaagatttacttgaacaagcttacgagcggttcgt |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26517617 |
ttctgttggtctttcataattggggaatctaactgtatactcatatcagatatgatgaacaaatggaagatttacttgaacaagcttacgagcggttcgt |
26517518 |
T |
 |
| Q |
217 |
gataaaaaaggaagggactgcaaagcagcgtaagcgtattaagaaattttatgatgcagactctctacttttggaggtatggagctctcttttgtgattg |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26517517 |
gataaaaaaggaagggactgcaaagcagcgtaagcgtattaagaaattttatgatgcagactctctacttttggaggtatggagctctcttttgtgattg |
26517418 |
T |
 |
| Q |
317 |
tagatgtaattattataccttcagttttgtgagttatataaagggaaatgaaactatatccg |
378 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26517417 |
tagatgtaattattataccttcaggtttgtgagttatataaagggaaatgaaactatatccg |
26517356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 152; E-Value: 2e-80
Query Start/End: Original strand, 107 - 329
Target Start/End: Complemental strand, 30374396 - 30374176
Alignment:
| Q |
107 |
cactgttttattctgttggtctttcataattggggaatctaactgtatactcatatcagatatgatgaacaaatggaagatttacttgaacaagcttacg |
206 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||| | |
|
|
| T |
30374396 |
cactgttttattctgttggtctttcataactggggaatctaactgtatactcaaatcagatatgatgaacaaatggaggatttacttgaacaagcttatg |
30374297 |
T |
 |
| Q |
207 |
agcggttcgtgataaaaaaggaagggactgcaaagcagcgtaagcgtattaagaaattttatgatgcagactctctacttttggaggtatggagctctct |
306 |
Q |
| |
|
||||||| |||||||||||||||||||||||| |||||||||||||||| ||||||| || ||||||||||| | |||||||||||||||||| || | |
|
|
| T |
30374296 |
agcggtttgtgataaaaaaggaagggactgcacagcagcgtaagcgtatcaagaaatcctacgatgcagactcccaacttttggaggtatggag--cttt |
30374199 |
T |
 |
| Q |
307 |
tttgtgattgtagatgtaattat |
329 |
Q |
| |
|
|||||||||||| ||||| |||| |
|
|
| T |
30374198 |
tttgtgattgtatatgtagttat |
30374176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 17 - 101
Target Start/End: Complemental strand, 30374760 - 30374673
Alignment:
| Q |
17 |
caaaggtggcttggagcattcttctagcgacttagattttgatgaaaaacgtagaaggtgatcgac---ttcttttgatattgttctt |
101 |
Q |
| |
|
||||||||||| ||||||||| ||||| |||||||||| ||| ||| |||||||||||||| | || ||||||||||||||||||| |
|
|
| T |
30374760 |
caaaggtggctcggagcattcatctagtgacttagattctgacgaagaacgtagaaggtgaacaactggttcttttgatattgttctt |
30374673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0131 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: scaffold0131
Description:
Target: scaffold0131; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 18 - 62
Target Start/End: Original strand, 13211 - 13255
Alignment:
| Q |
18 |
aaaggtggcttggagcattcttctagcgacttagattttgatgaa |
62 |
Q |
| |
|
|||||||||| ||||||||| ||||| |||||| ||||||||||| |
|
|
| T |
13211 |
aaaggtggctcggagcattcatctagtgacttatattttgatgaa |
13255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University