View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17259_low_37 (Length: 321)
Name: NF17259_low_37
Description: NF17259
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17259_low_37 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 260; Significance: 1e-145; HSPs: 8)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 260; E-Value: 1e-145
Query Start/End: Original strand, 18 - 301
Target Start/End: Original strand, 38150924 - 38151207
Alignment:
| Q |
18 |
acccttgactatagagcagtggaagtataaggagcagtagaagctactcacaattccaaattgttgcaattgataatgcctcatgttttattatttagtg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
38150924 |
acccttgactatagagcagtggaagtataaggagcagtagaagctactcacaattccaaattgttgcaattgataatgcctcatgtttcgttatttagtg |
38151023 |
T |
 |
| Q |
118 |
tccgcgatttggttatgttttgcaatagctcacttctttctatacaactctgaatcagatggcacaaagagtatctatgatcaatttttgggcattttat |
217 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38151024 |
tccgcaatttggttatgttttgcaatagctcacttctttctatacaactctgaatcggatggcacaaagagtatctatgatcaatttttgggcattttat |
38151123 |
T |
 |
| Q |
218 |
accctttaacactaaagattttggaatagaactgtactgtaatagtgagtgaggtttacctttagtttcgtggcaatttgtttt |
301 |
Q |
| |
|
||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38151124 |
accctttaacactaatgattttggaaaagaactgtactgtaatagtgagtgaggtttacctttagtttcgtggcaatttgtttt |
38151207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 25 - 82
Target Start/End: Original strand, 38221589 - 38221646
Alignment:
| Q |
25 |
actatagagcagtggaagtataaggagcagtagaagctactcacaattccaaattgtt |
82 |
Q |
| |
|
|||||||||||||||||||||| ||||| |||||| ||||||||||||||||| |||| |
|
|
| T |
38221589 |
actatagagcagtggaagtatatggagctgtagaacctactcacaattccaaactgtt |
38221646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 193 - 245
Target Start/End: Complemental strand, 38454385 - 38454333
Alignment:
| Q |
193 |
tatgatcaatttttgggcattttataccctttaacactaaagattttggaata |
245 |
Q |
| |
|
|||||||||||| |||||||||||||| ||||||||||| || ||||||||| |
|
|
| T |
38454385 |
tatgatcaatttgcgggcattttataccgtttaacactaatgagtttggaata |
38454333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 271 - 305
Target Start/End: Original strand, 38170617 - 38170651
Alignment:
| Q |
271 |
gtttacctttagtttcgtggcaatttgttttctgt |
305 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |
|
|
| T |
38170617 |
gtttacctttagtttcgtggtaatttgttttctgt |
38170651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 193 - 245
Target Start/End: Complemental strand, 38179469 - 38179417
Alignment:
| Q |
193 |
tatgatcaatttttgggcattttataccctttaacactaaagattttggaata |
245 |
Q |
| |
|
|||||||||||| ||||||||| |||| ||||||||||| || ||||||||| |
|
|
| T |
38179469 |
tatgatcaatttgcgggcattttgtaccgtttaacactaatgagtttggaata |
38179417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 193 - 245
Target Start/End: Original strand, 38191662 - 38191714
Alignment:
| Q |
193 |
tatgatcaatttttgggcattttataccctttaacactaaagattttggaata |
245 |
Q |
| |
|
|||||||||||| ||||||||| |||| ||||||||||| || ||||||||| |
|
|
| T |
38191662 |
tatgatcaatttgcgggcattttgtaccgtttaacactaatgagtttggaata |
38191714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 193 - 245
Target Start/End: Complemental strand, 38206693 - 38206641
Alignment:
| Q |
193 |
tatgatcaatttttgggcattttataccctttaacactaaagattttggaata |
245 |
Q |
| |
|
|||||||||||| ||||||||| |||| ||||||||||| || ||||||||| |
|
|
| T |
38206693 |
tatgatcaatttgcgggcattttgtaccgtttaacactaatgagtttggaata |
38206641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 193 - 245
Target Start/End: Original strand, 38218887 - 38218939
Alignment:
| Q |
193 |
tatgatcaatttttgggcattttataccctttaacactaaagattttggaata |
245 |
Q |
| |
|
|||||||||||| ||||||||| |||| ||||||||||| || ||||||||| |
|
|
| T |
38218887 |
tatgatcaatttgcgggcattttgtaccgtttaacactaatgagtttggaata |
38218939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University