View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17259_low_51 (Length: 249)
Name: NF17259_low_51
Description: NF17259
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17259_low_51 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 62; Significance: 7e-27; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 128 - 189
Target Start/End: Original strand, 8566555 - 8566616
Alignment:
| Q |
128 |
caataaaacatgagttcctatgtttgcaagatgaatagttgagtgtgtttatgagtttgatg |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8566555 |
caataaaacatgagttcctatgtttgcaagatgaatagttgagtgtgtttatgagtttgatg |
8566616 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 8566443 - 8566490
Alignment:
| Q |
1 |
gggtatcaaaagtgtgctaactaactttaatgctcgtaatgaaaatat |
48 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8566443 |
gggtatcaaaagtgtgctaactaactttaatgctcgtaatgaaaatat |
8566490 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University