View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17259_low_64 (Length: 208)
Name: NF17259_low_64
Description: NF17259
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17259_low_64 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 127; Significance: 9e-66; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 127; E-Value: 9e-66
Query Start/End: Original strand, 18 - 156
Target Start/End: Complemental strand, 5033643 - 5033505
Alignment:
| Q |
18 |
aaatttagtttatgtagttaaaatctgttgtagaaaactagtctatgagagactcgtatggctaagtgtcagataatttcaaccttaacctagtgattag |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5033643 |
aaatttagtttatgtagttaaaatctgttgtagaaaacttgtctatgagagactcgtatggccaagtgtcagataatttcaaccttaacctagtgattag |
5033544 |
T |
|
| Q |
118 |
ctaaaacaattctcagctcatacaagaagaaatagtctt |
156 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
5033543 |
ctaaaacaattcttagctcatacaagaagaaatagtctt |
5033505 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 144 - 191
Target Start/End: Complemental strand, 5033487 - 5033440
Alignment:
| Q |
144 |
aagaaatagtctttatactcatgctgcgagacattactaaactttctc |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5033487 |
aagaaatagtctttatactcatgctgcgagacattactaaactttctc |
5033440 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University