View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1725_high_1 (Length: 632)
Name: NF1725_high_1
Description: NF1725
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1725_high_1 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 36; Significance: 0.00000000006; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 549 - 588
Target Start/End: Complemental strand, 27734129 - 27734090
Alignment:
| Q |
549 |
catctctttaaagacaacctcatacatatgtatcatgttc |
588 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
27734129 |
catctctttaaagacaacctcatacatatgtattatgttc |
27734090 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University