View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1725_low_8 (Length: 261)
Name: NF1725_low_8
Description: NF1725
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1725_low_8 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 9 - 245
Target Start/End: Complemental strand, 52300202 - 52299966
Alignment:
| Q |
9 |
agcagagatgtttctgattgaaaatcttggatcatatgacccagatcatgaattcatcgataaatttctcaattacatggagttactaccttctgaagtt |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
52300202 |
agcagagatgtttctgattgaaaatcttggatcatatgacccagatcatgaattcatcgataaatttctcaattacatggagttactaccttccgaagtt |
52300103 |
T |
|
| Q |
109 |
ctggaaatagcttttcagactcagaatgatcggatagtcggtggaggcgtgatatctggaaatataaatttacaggatctgcgacagacagatggatcct |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52300102 |
ctggaaatagcttttcagactcagaatgatcggagagtcggtggaggcgtgatatctggaaatataaatttacaggatctgcgacagacagatggatcct |
52300003 |
T |
|
| Q |
209 |
tctcaaaaggtggagagaagggtaagaaagggaaaaa |
245 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||| |
|
|
| T |
52300002 |
tctcaaaaggtggaaagaagggtaagaaagggaaaaa |
52299966 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University