View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17260_high_41 (Length: 376)
Name: NF17260_high_41
Description: NF17260
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17260_high_41 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 171; Significance: 9e-92; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 171; E-Value: 9e-92
Query Start/End: Original strand, 19 - 201
Target Start/End: Complemental strand, 47177889 - 47177707
Alignment:
| Q |
19 |
tttaagccaatgtatgtttctgcaacagctaagcccatcaacgcgcgtccggtcaatgctactaatttgtagctttgtaaaaatcacggtagttttgctt |
118 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||| |
|
|
| T |
47177889 |
tttaagccaatgtatgtttctgcgacagctaagcccatcaacgcgcgtccggtcaatgctactaatttgtagctttgtaaaaatcacggtggtttcgctt |
47177790 |
T |
 |
| Q |
119 |
tgggacacagcgaacgagttgaaacagagtgcaatgtgcacataaagattttagagggaaaatgagaactgcattattttatg |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47177789 |
tgggacacagcgaacgagttgaaacagagtgcaatgtgcacataaagattttagagggaaaatgagaactgcattattttatg |
47177707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 266 - 318
Target Start/End: Complemental strand, 47177610 - 47177558
Alignment:
| Q |
266 |
ccaccactatcaaatctgcaaccacaaatccacaatcacaatttaaaaacttt |
318 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47177610 |
ccaccactatcaaatctgcaaccacaaatccacaatcacaatttaaaaacttt |
47177558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University