View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17260_high_58 (Length: 288)
Name: NF17260_high_58
Description: NF17260
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17260_high_58 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 14 - 271
Target Start/End: Complemental strand, 5484179 - 5483921
Alignment:
| Q |
14 |
ctcaaaatctgaaacaaatgtatggtaggagtcgcaaatacaaaacagagaaacaaaacacgaagaaagggaaattttcatttttaagttgagatccctt |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5484179 |
ctcaaaatctgaaacaaatgtatggtaggagtcgcaaatacaaaacagagaaacaaaacacaaagaaagggaaattttcatttttaagttgagatccctt |
5484080 |
T |
|
| Q |
114 |
catacatgtttgttgcaagacaacgatatcaaac-nnnnnnnnnnnnnnnnnnncaaaagggaactgggaaacaattgctggatgaccccaattttttca |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5484079 |
catacatgtttgttgcaagacaacgatatcaaacatttttttttttttttttttcataagggaactgggaaacaattgctggatgaccccaattttttca |
5483980 |
T |
|
| Q |
213 |
taaaattatacattgcacatactccgagtcagttggttggggagatatatcatgtcaac |
271 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
5483979 |
taaaattatacattgcacatactccgagtcagttggttggggagaaatatcatgtcaac |
5483921 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University