View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17260_high_66 (Length: 271)
Name: NF17260_high_66
Description: NF17260
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17260_high_66 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 255; Significance: 1e-142; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 13 - 271
Target Start/End: Complemental strand, 38626078 - 38625820
Alignment:
| Q |
13 |
tgatgatgttcactatgaaagaagttctgctacaggagaaaacataaaattggtatgaagtaagttatgcatgatgtttataacttctattgtttttact |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38626078 |
tgatgatgttcactatgaaagaagttctgctacaggagaaaacataaaattggtatgaagtaagttatgcatgatgtttataacttctattgtttttact |
38625979 |
T |
 |
| Q |
113 |
ttgattcaaatactgggattctatttgttttcaatgatcaaaatgaaatgtttttgaatcgtaagaacatgcttcattatattttcagctaatactacca |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
38625978 |
ttgattcaaatactgggattctatttgttttcaatgatcaaaatgaaatgtttttgaatcgtaagaacatgcttcattatattttcagctaatactgcca |
38625879 |
T |
 |
| Q |
213 |
cttctgtaaagaaaatttcttacttgtatgtcctagcattagacggttcctttgctact |
271 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38625878 |
cttctgtaaagaaaatttcttacttgtatgtcctagcattagacggttcctttgctact |
38625820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University