View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17260_high_70 (Length: 261)
Name: NF17260_high_70
Description: NF17260
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17260_high_70 |
 |  |
|
| [»] chr4 (3 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 237; Significance: 1e-131; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 17 - 261
Target Start/End: Original strand, 2290042 - 2290286
Alignment:
| Q |
17 |
gattttccaattgcggtttttcagcgacaactgcattcaaagcttcttcagaaacttgtttcaccggttcagtcatagaagtgtcttccacttgaggctt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2290042 |
gattttccaattgcggtttttcagcgacaactgcattcaaagcttcttcagaaacttgtttcaccggttcagtcatagaagtgtcttccacttgaggctt |
2290141 |
T |
 |
| Q |
117 |
ttccaaatgcggttttgcagcagcaacagtagacaaagcatgcacaataattcgtttcgccggttcagccatcaatgtaggcttctcagctatcacagtt |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
2290142 |
ttccaaatgcggttttgcagcagcaacagtagacaaagcatgcacaataattcgtttcgccggttcggccatcaatgtaggcttctcagctatcacagtt |
2290241 |
T |
 |
| Q |
217 |
tcaccttccacattactttgcttaatttcctcagcattgacgttc |
261 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2290242 |
tcagcttccacattactttgcttaatttcctcagcattgacgttc |
2290286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 31 - 122
Target Start/End: Original strand, 2289723 - 2289814
Alignment:
| Q |
31 |
ggtttttcagcgacaactgcattcaaagcttcttcagaaacttgtttcaccggttcagtcatagaagtgtcttccacttgaggcttttccaa |
122 |
Q |
| |
|
||||||||||| ||||| || | ||||||||| |||||| ||||| ||||||||| | || ||| | ||||||||||||||||||||||| |
|
|
| T |
2289723 |
ggtttttcagcaacaacagcgtccaaagcttccacagaaagttgttccaccggttccgccagagatggttcttccacttgaggcttttccaa |
2289814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 97 - 137
Target Start/End: Original strand, 2290026 - 2290066
Alignment:
| Q |
97 |
gtgtcttccacttgaggcttttccaaatgcggttttgcagc |
137 |
Q |
| |
|
||||||||||||||||| |||||||| ||||||||| |||| |
|
|
| T |
2290026 |
gtgtcttccacttgaggattttccaattgcggtttttcagc |
2290066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University