View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17260_high_73 (Length: 256)
Name: NF17260_high_73
Description: NF17260
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17260_high_73 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 176; Significance: 7e-95; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 176; E-Value: 7e-95
Query Start/End: Original strand, 21 - 246
Target Start/End: Complemental strand, 35489832 - 35489611
Alignment:
| Q |
21 |
taagaaaaatgccgaagtgtacgaactttgcatgaaaacatggtattaattctttcatgcatatttggtnnnnnnnnngagaaaccgcttgtaatcagca |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
35489832 |
taagaaaaatgccgaagtgtacgaactttgcatgaaaacatggtattaattctttcatgcatatttggtaaaaa-----agaaaccgcttgtaatcagca |
35489738 |
T |
 |
| Q |
121 |
acaatgttttt-atatacaaaaagtagatatatttgattgaagaaaaggatataaggtttaactagtgtttaacttacgttctctcatagactgtgcttg |
219 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
35489737 |
acaatgttttttatatacaaaaagtagatatatttgattgtagaaaaggatataaggtttaactaatgtttaacttacgttctctcatagactgtgcttg |
35489638 |
T |
 |
| Q |
220 |
aatcagtgaagtaaataacaccttcat |
246 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
35489637 |
aatcagtgaagtaaataacaccttcat |
35489611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 207 - 248
Target Start/End: Complemental strand, 35503104 - 35503063
Alignment:
| Q |
207 |
tagactgtgcttgaatcagtgaagtaaataacaccttcatct |
248 |
Q |
| |
|
||||||||||||||||||||||||||||| ||| |||||||| |
|
|
| T |
35503104 |
tagactgtgcttgaatcagtgaagtaaatcacatcttcatct |
35503063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 191 - 248
Target Start/End: Complemental strand, 40160322 - 40160265
Alignment:
| Q |
191 |
aacttacgttctctcatagactgtgcttgaatcagtgaagtaaataacaccttcatct |
248 |
Q |
| |
|
||||||| |||||| |||||||||||||||||||||||||||||| ||| |||||||| |
|
|
| T |
40160322 |
aacttaccttctctgatagactgtgcttgaatcagtgaagtaaatcacatcttcatct |
40160265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University