View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17260_high_76 (Length: 249)
Name: NF17260_high_76
Description: NF17260
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17260_high_76 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 37 - 249
Target Start/End: Complemental strand, 3968698 - 3968488
Alignment:
| Q |
37 |
tgaatataatttcatgtgattaaaggtgttggcgctaaacaacatacaaactcataattggcaagatttaaattttgggttgagttgtgctgttaatcct |
136 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||| || ||| ||||||| |
|
|
| T |
3968698 |
tgaatataatttcatgtgattaaaggtgttggcgctaaacaacatacaaactcataattggtaagattcaaattttgggttgagctg--ctgctaatcct |
3968601 |
T |
|
| Q |
137 |
ttatggatgacaaaatcaatcattttaattctaaaatcatagatctaggtgactcaacattgttatgtgtgatcctttgaactttttatagaaggtcaac |
236 |
Q |
| |
|
|| || ||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||| |
|
|
| T |
3968600 |
ttttgaatgacaaaatcaatccttttaattccaaaatcatagatctaggtgactcaacattgttatgcgtgatcctttgaactttttatagaaggttaac |
3968501 |
T |
|
| Q |
237 |
aaactcagatact |
249 |
Q |
| |
|
||||||||||||| |
|
|
| T |
3968500 |
aaactcagatact |
3968488 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.00000008; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 193 - 238
Target Start/End: Complemental strand, 10950785 - 10950740
Alignment:
| Q |
193 |
acattgttatgtgtgatcctttgaactttttatagaaggtcaacaa |
238 |
Q |
| |
|
|||||||||| ||||| |||||||||||| | |||||||||||||| |
|
|
| T |
10950785 |
acattgttatatgtgaccctttgaactttatgtagaaggtcaacaa |
10950740 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 193 - 238
Target Start/End: Complemental strand, 10958790 - 10958745
Alignment:
| Q |
193 |
acattgttatgtgtgatcctttgaactttttatagaaggtcaacaa |
238 |
Q |
| |
|
|||||||||| ||||| |||||||||||| | |||||||||||||| |
|
|
| T |
10958790 |
acattgttatatgtgaccctttgaactttatgtagaaggtcaacaa |
10958745 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University