View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17260_high_78 (Length: 248)

Name: NF17260_high_78
Description: NF17260
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17260_high_78
NF17260_high_78
[»] chr1 (1 HSPs)
chr1 (143-242)||(41692995-41693094)


Alignment Details
Target: chr1 (Bit Score: 100; Significance: 1e-49; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 143 - 242
Target Start/End: Original strand, 41692995 - 41693094
Alignment:
143 gcaccctagtaagtaaactactactaatacaaacaatatagacttcagtagttttcaaaaattcacgtgattcttttttgtcccttttcattttcatctc 242  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41692995 gcaccctagtaagtaaactactactaatacaaacaatatagacttcagtagttttcaaaaattcacgtgattcttttttgtcccttttcattttcatctc 41693094  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University