View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17260_high_78 (Length: 248)
Name: NF17260_high_78
Description: NF17260
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17260_high_78 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 100; Significance: 1e-49; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 143 - 242
Target Start/End: Original strand, 41692995 - 41693094
Alignment:
| Q |
143 |
gcaccctagtaagtaaactactactaatacaaacaatatagacttcagtagttttcaaaaattcacgtgattcttttttgtcccttttcattttcatctc |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41692995 |
gcaccctagtaagtaaactactactaatacaaacaatatagacttcagtagttttcaaaaattcacgtgattcttttttgtcccttttcattttcatctc |
41693094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University