View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17260_high_80 (Length: 247)
Name: NF17260_high_80
Description: NF17260
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17260_high_80 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 6 - 231
Target Start/End: Original strand, 36109154 - 36109369
Alignment:
| Q |
6 |
gaagaatatgagtggtgtttataaactaaatttagtttacaaacaagtccatttagcttgtgttttcgaggcattgtccgttttaggtgtgtatgatacg |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
36109154 |
gaagaatatgagtggtgtttataaactaaatttagtttacaaacaagtccatttagcttgtgttttcgaggtattgtccgttttaggtgtgtatgatacg |
36109253 |
T |
 |
| Q |
106 |
ctttggcttgtgtctcaacttctaaataatgtgggactattttagtttaacggagtactgcccgaacacgcataactatcactcgtttaaggtttgatta |
205 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36109254 |
ctttggcttgtgtctcaacttctaaata----------attttagtttaacggagtactgcccgaacacgcataactatcactcgtttaaggtttgatta |
36109343 |
T |
 |
| Q |
206 |
atgttgattaattctttattaattca |
231 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
36109344 |
atgttgattaattctttattaattca |
36109369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University