View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17260_high_85 (Length: 243)
Name: NF17260_high_85
Description: NF17260
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17260_high_85 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 146; Significance: 5e-77; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 1 - 166
Target Start/End: Complemental strand, 35282783 - 35282618
Alignment:
| Q |
1 |
tgtttgagtagaatttttcttgaacctacttggtttcctagtttggatgctgctaagacttttcttggctattattgggaaaatagtgagaatagtagaa |
100 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
35282783 |
tgtttgagtaggatttttcttgaacctacttggtttcctagcttggatgctgccaagacttttcttgggtattattgggaaaatagtgagaatagtagaa |
35282684 |
T |
 |
| Q |
101 |
atacttggtgattcctatgagattatgttggatattaggatctaaacttagaaacatacatgattg |
166 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35282683 |
atacttggtgattcatatgagattatgttggatattaggatctaaacttagaaacatacatgattg |
35282618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 19 - 68
Target Start/End: Complemental strand, 31472674 - 31472625
Alignment:
| Q |
19 |
cttgaacctacttggtttcctagtttggatgctgctaagacttttcttgg |
68 |
Q |
| |
|
||||||||||| | |||||||| |||||||||||||||||||||||||| |
|
|
| T |
31472674 |
cttgaacctacctactttcctagcttggatgctgctaagacttttcttgg |
31472625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University