View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17260_high_88 (Length: 240)
Name: NF17260_high_88
Description: NF17260
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17260_high_88 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 142; Significance: 1e-74; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 18 - 159
Target Start/End: Original strand, 39075110 - 39075251
Alignment:
| Q |
18 |
tttttacgtaagtcttgtagctgacgtacgtttgagttacttcaaacacgcaggtccatatttgttttcaagaaacttcttgttttggtcacacagttct |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39075110 |
tttttacgtaagtcttgtagctgacgtacgtttgagttacttcaaacacgcaggtccatatttgttttcaagaaacttcttgttttggtcacacagttct |
39075209 |
T |
 |
| Q |
118 |
gtttgtagtatggtttgttttgggactaatctgattacattt |
159 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39075210 |
gtttgtagtatggtttgttttgggactaatctgattacattt |
39075251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 181 - 223
Target Start/End: Original strand, 39075248 - 39075290
Alignment:
| Q |
181 |
atttgtcccttcatatggctgactattttatagtgtgaaccat |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39075248 |
atttgtcccttcatatggctgactattttatagtgtgaaccat |
39075290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University