View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17260_low_29 (Length: 439)
Name: NF17260_low_29
Description: NF17260
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17260_low_29 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 279; Significance: 1e-156; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 279; E-Value: 1e-156
Query Start/End: Original strand, 10 - 423
Target Start/End: Original strand, 48705869 - 48706266
Alignment:
| Q |
10 |
agatgaatatttctcaagttcgctaggtttacatgggtcgtggttgtgtcagaattaagacacaggggagagacgagggacacaagcataagagagatgg |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48705869 |
agatgaatatttctcaagttcgctaggtttacatgggtcgtggtagtgtcagaattaagacacaggggagagacgagggacacaagcataagagagatgg |
48705968 |
T |
 |
| Q |
110 |
atgttt-tacgaaattgtccttccactttaaaggaaattacgaaaaatgctattggtatcatatttgtgcggggatcatgttagaacatttgt-aatcat |
207 |
Q |
| |
|
|||||| ||||||||||| |||||||||||||||||||||||| || |||||||||||||||||| |||| ||||||||||| |||||| |
|
|
| T |
48705969 |
atgtttctacgaaattgt------------aaggaaattacgaaaaatgctattagtgtcatatttgtgcggggattatgtcagaacatttgttaatcat |
48706056 |
T |
 |
| Q |
208 |
tcagaataatgacaagagatgcatgggaggttgcggtagggacgatgatgttaatcatttgttcattcgttgcgatattttgggaagatttggtatttac |
307 |
Q |
| |
|
|||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||| |||||||| || ||||||||||||||||| ||| | |
|
|
| T |
48706057 |
-----ataatgacaagagacgcatgggaggttgaggtagggacgatgatgttaatcatttgttcgttcgttgcaattttttgggaagatttggtctttgc |
48706151 |
T |
 |
| Q |
308 |
tctctctttggttaggatgtgtcacggcaggtctagactctatatcaaaacattttgctcattttacttctctcacaaggttctctaagaaccttcgcaa |
407 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
48706152 |
tctctctttggttaggatgtgtcacggcaggtctagactctatatcagaacattttgctcattttacttctctcac-aggttctctaagaaccttcgcaa |
48706250 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 39; Significance: 0.0000000000007; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 314 - 403
Target Start/End: Original strand, 27163176 - 27163263
Alignment:
| Q |
314 |
tttggttaggatgtgtcacggcaggtctagactctatatcaaaacattttgctcattttacttctctcacaaggttctctaagaaccttc |
403 |
Q |
| |
|
|||||||||| || ||||| || |||||| |||||||||| | |||||||||||||||| ||||||||||| ||||||||||| |||| |
|
|
| T |
27163176 |
tttggttagggtgcgtcacaacaagtctaggctctatatcagatcattttgctcatttta--tctctcacaagtttctctaagaatcttc |
27163263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 113 - 177
Target Start/End: Original strand, 12496911 - 12496975
Alignment:
| Q |
113 |
ttttacgaaattgtccttccactttaaaggaaattacgaaaaatgctattggtatcatatttgtg |
177 |
Q |
| |
|
|||||| ||||||||||| || ||||||||||||||| |||||| |||||| |||| |||||| |
|
|
| T |
12496911 |
ttttacaaaattgtccttgcaatttaaaggaaattacaaaaaatctcattggtgtcatttttgtg |
12496975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University