View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17260_low_41 (Length: 378)
Name: NF17260_low_41
Description: NF17260
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17260_low_41 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 342; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 342; E-Value: 0
Query Start/End: Original strand, 15 - 364
Target Start/End: Complemental strand, 50463881 - 50463532
Alignment:
| Q |
15 |
aatatgggaaagaaaaatttgaaactaccttctcttttcaaaaccaaagaaatttcacaaagaaaacaacatccatggcaattcttaccctcttgtgccc |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
50463881 |
aatatgggaaagaaaaatttgaaactaccttctcttttcaaaaccaaagaaatttcacaaagaaaacaacatccatggcaattcttaccctcttgtggcc |
50463782 |
T |
 |
| Q |
115 |
atccaaaaactctttcttttcgagttggtgctgcttctgcttctgctgctgatgatcacatattcaaaacggttaattctgtgttttttgaccaaacaga |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50463781 |
atccaaaaactctttcttttcgagttggtgctgcttctacttctgctgctgatgatcacatattcaaaacggttaattctgtgttttttgaccaaacaga |
50463682 |
T |
 |
| Q |
215 |
caacattaatatagaaacaccaaaatcatggttcacaacatcatctgaatctgcaagtttctcaacagaatcagaagattactattgctacaacgacggc |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50463681 |
caacattaatatagaaacaccaaaatcatggttcacaacatcatctgaatctgcaagtttctcaacagaatcagaagattactattgctacaacgacggc |
50463582 |
T |
 |
| Q |
315 |
gaatcattggagacattggtacgaggagttaagtcggagagattgttttt |
364 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50463581 |
gaatcattggagacattggtacgaggagttaagtcggagagattgttttt |
50463532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University