View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17260_low_57 (Length: 297)
Name: NF17260_low_57
Description: NF17260
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17260_low_57 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 15 - 278
Target Start/End: Complemental strand, 10665485 - 10665222
Alignment:
| Q |
15 |
aatatttcatattctacaatgtataataacactggctttgggaagattcaaggtattattaaattccatgcannnnnnnccaactcatctaagatatttt |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
10665485 |
aatatttcatattctacaatgtataataacactagctttgggaagattcaaggtattattaaattccatgcatttttttccaactcatctaagatatttt |
10665386 |
T |
 |
| Q |
115 |
ctatcataaagttttttattacgtacaagacttttcttttctttgtttgtctctacctaaattcacaatttgcttcagatgaggaggtggaagaaatggg |
214 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10665385 |
ctattataaagttttttattacgtacaagacttttcttttctttgtttgtctctacctaaattcacaatttgcttcagatgaggaggtggaagaaatggg |
10665286 |
T |
 |
| Q |
215 |
aggatgaaacaagaaccgttgaatatcaattctataatggtaacatttctcgttgattattatt |
278 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10665285 |
aggatgaaacaagaaccgttgaatatcaattctataatggtaacatttctcgttgattattatt |
10665222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University