View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17260_low_61 (Length: 284)
Name: NF17260_low_61
Description: NF17260
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17260_low_61 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 250; Significance: 1e-139; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 14 - 267
Target Start/End: Complemental strand, 7423718 - 7423465
Alignment:
| Q |
14 |
gaaatctaagcaatcaacttattttataatatattaattcataagtaagtgtagtctttgccatgcatcatgaataaaaagtaaccaatgctccaccaac |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7423718 |
gaaatctaagcaatcaacttattttataatatattaattcataagtaagtgtagtctttgccatgcatcatgaataaaaagtaaccaatgctccaccaac |
7423619 |
T |
 |
| Q |
114 |
cataaccgtcacctgtgtattaggccgcaaaagctaccatcggttgacaacttggcttcttgttaattgacgtaggacataccatgtacgttgttgctgt |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7423618 |
cataaccgtcacctgtgtattaggccgcaaaagctaccatcggttgacaacttggcttcttgttaattgacgtaggacataccatgtacgttgttgctgt |
7423519 |
T |
 |
| Q |
214 |
tgatggatcgagacagagccgtatctcggccaagtaattgccggcagcaacaca |
267 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
7423518 |
tgatggatcgagacagagccgtatctcggccaagtaattgccggcggcaacaca |
7423465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University