View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17260_low_73 (Length: 258)
Name: NF17260_low_73
Description: NF17260
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17260_low_73 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 9 - 244
Target Start/End: Complemental strand, 45272219 - 45271984
Alignment:
| Q |
9 |
ggacatcatcagagaaggaaattggtggcgatgaagaagaatctactcaacgttaagaatctgcagaagaatagcatgaacaaaatgatggcctgcgctg |
108 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45272219 |
ggacatcataagagaaggaaattggtggcgatgaagaagaatctactcaacgttaagaatctgcagaagaatagcatgaacaaaatgatggcctgcgctg |
45272120 |
T |
|
| Q |
109 |
gcaatgatagaagaaaacttcttgcggatcattgattaatacattagttcctgctagaacgaatgttgaagacacattaattatataataacttagaaat |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45272119 |
gcaatgatagaagaaaacttcttgcggatcattgattaatacattagttgctgctagaacgaatgttgaagacacattaattatataataacttagaaat |
45272020 |
T |
|
| Q |
209 |
aagtgtttctttgtttgggaatttctaggcattttt |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
45272019 |
aagtgtttctttgtttgggaatttctaggcattttt |
45271984 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University