View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17260_low_83 (Length: 247)
Name: NF17260_low_83
Description: NF17260
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17260_low_83 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 199; Significance: 1e-108; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 29 - 239
Target Start/End: Original strand, 43744632 - 43744841
Alignment:
| Q |
29 |
gttataaaagggtggtgaggatacattattatacttcataggtttgaccattccaatccctacggcatacatgcaaattgaatagttttagggaccctaa |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43744632 |
gttataaaagggtggtgaggatacattattatacttcataggtttgaccattccaatccctacggcatacatgcaaattgaatagttttagggaccctaa |
43744731 |
T |
|
| Q |
129 |
ataatgcccacctcatagcataaaatttaaaataatcagatttgtcaaatcttaataaagtaattagccgatcaataatcttgagaaagagtgcgtatat |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
43744732 |
ataatgcccacctcatagcataaaatttaaaataatcagatttgtcaaatcttaataaagtaattagccgatcaataatcttgagaaagagtgcgtatgt |
43744831 |
T |
|
| Q |
229 |
agtatagtata |
239 |
Q |
| |
|
| ||||||||| |
|
|
| T |
43744832 |
a-tatagtata |
43744841 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 1 - 39
Target Start/End: Original strand, 43744188 - 43744226
Alignment:
| Q |
1 |
atcctaattaattgaaaatgataaacgggttataaaagg |
39 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43744188 |
atcctaattaattgaaaatgataaacgggttataaaagg |
43744226 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University