View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17260_low_90 (Length: 240)

Name: NF17260_low_90
Description: NF17260
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17260_low_90
NF17260_low_90
[»] chr2 (2 HSPs)
chr2 (18-159)||(39075110-39075251)
chr2 (181-223)||(39075248-39075290)


Alignment Details
Target: chr2 (Bit Score: 142; Significance: 1e-74; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 18 - 159
Target Start/End: Original strand, 39075110 - 39075251
Alignment:
18 tttttacgtaagtcttgtagctgacgtacgtttgagttacttcaaacacgcaggtccatatttgttttcaagaaacttcttgttttggtcacacagttct 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39075110 tttttacgtaagtcttgtagctgacgtacgtttgagttacttcaaacacgcaggtccatatttgttttcaagaaacttcttgttttggtcacacagttct 39075209  T
118 gtttgtagtatggtttgttttgggactaatctgattacattt 159  Q
    ||||||||||||||||||||||||||||||||||||||||||    
39075210 gtttgtagtatggtttgttttgggactaatctgattacattt 39075251  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 181 - 223
Target Start/End: Original strand, 39075248 - 39075290
Alignment:
181 atttgtcccttcatatggctgactattttatagtgtgaaccat 223  Q
    |||||||||||||||||||||||||||||||||||||||||||    
39075248 atttgtcccttcatatggctgactattttatagtgtgaaccat 39075290  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University